This article introduces a newly established minimum data standard for wildlife disease research, a critical advancement for researchers, scientists, and drug development professionals.
This article introduces a newly established minimum data standard for wildlife disease research, a critical advancement for researchers, scientists, and drug development professionals. It explores the foundational need for standardized metadata to address current data fragmentation and the omission of negative results. The content provides a methodological guide for implementing the standard's 40 data fields, discusses strategies for overcoming real-world surveillance challenges like data sensitivity and interoperability, and validates the approach through its alignment with FAIR principles and application in active research networks. By synthesizing these elements, the article outlines a path toward more predictive ecological modeling and robust early-warning systems for emerging zoonotic threats.
Problem: Inconsistent data formats and missing metadata make it difficult to combine datasets from different wildlife disease studies for large-scale analysis.
Solution: Adopt a minimum data standard to ensure all necessary fields are collected in a consistent, machine-readable format.
wddsWizard), to check your dataset's compliance with the standard before sharing [1] [4].Problem: Summary reports that omit negative test results prevent accurate calculation of disease prevalence and bias understanding of disease dynamics.
Solution: Report all diagnostic results at the individual level, not as summaries.
Problem: High-resolution spatial data is essential for ecological analysis but can pose a risk to threatened species if shared publicly.
Solution: Implement data obfuscation techniques that balance transparency with safety.
FAQ 1: What is the minimum data standard for wildlife disease research and why is it needed?
The minimum data standard is a community-developed framework for recording and sharing wildlife disease data. It defines a set of 40 data fields and 24 metadata fields to ensure data is Findable, Accessible, Interoperable, and Reusable (FAIR). It addresses the critical issue of data fragmentation, where studies use incompatible formats or omit key information like negative results, making it nearly impossible to combine datasets for robust, large-scale analysis [1] [2].
FAQ 2: I only use PCR in my research. Do I need to fill out all 40 data fields?
No. The standard is designed to be flexible. You should complete the 9 required fields and then only the additional fields that are relevant to your study design and methods. For example, if you use PCR, you would fill out fields like "Forward primer sequence" and "Gene target," but you can ignore fields that are specific to other methods, such as ELISA [1].
FAQ 3: How does standardizing metadata help in pandemic preparedness?
Standardized metadata allows for the rapid aggregation and analysis of wildlife disease data from across the globe. When data on pathogen detection in wildlife is consistent and includes context like host details and location, it strengthens early warning systems. This helps public health officials identify emerging threats at the human-animal interface more quickly and accurately, which is a cornerstone of pandemic prevention [2] [5].
FAQ 4: Where should I deposit my data after formatting it according to the standard?
You should deposit your data in an open-access, generalist repository (such as Zenodo) or a specialist platform for disease data (like the PHAROS database). These platforms help ensure the long-term findability and preservation of your data [1] [2].
The following diagram illustrates the workflow for implementing the wildlife disease data standard to overcome data fragmentation.
The table below lists key resources for implementing the wildlife disease data standard in your research workflow.
| Item Name | Function/Benefit | Key Features |
|---|---|---|
| WDDS Template Files | Pre-formatted spreadsheets (.csv, .xlsx) ensure correct data structure from the start [1]. | Contains all 40 data fields; guides users on required vs. optional fields for their study. |
wddsWizard R Package |
Validates dataset structure and compliance with the standard before publication or sharing [1] [4]. | Checks data against JSON Schema; provides convenience functions for data restructuring. |
| PHAROS Database | A specialized platform for uploading, storing, and discovering standardized wildlife disease data [1]. | Facilitates data harmonization and aggregation across different studies and regions. |
| Controlled Vocabularies | Recommended lists of standardized terms for specific data fields (e.g., species names, diagnostic methods) [1]. | Improves data interoperability by reducing free-text inconsistencies between datasets. |
Q1: What types of missing data do researchers encounter, and why does it matter? Missing data falls into three categories, each with different implications for research integrity [6]:
Q2: How does omitting negative results or other missing data skew ecological understanding? Omitting data, particularly negative results, creates a biased and incomplete picture that can distort scientific inference [1] [7]. In wildlife disease research, if only positive test results are shared, it becomes impossible to accurately calculate disease prevalence, track outbreaks, or understand the true dynamics of pathogen transmission across populations, species, and time [1]. One review found that out of 110 studies on coronaviruses in bats, 96 reported data only in a summarized format, and among those sharing individual-level data, most shared only positive results [1]. This practice hinders large-scale data synthesis and can lead to incorrect conclusions about a studied phenomenon [7].
Q3: What are the consequences of simply deleting records with missing data? The most common method, list-wise deletion (removing any record with a missing value), has two major negative consequences [7]:
Q4: What advanced statistical methods can handle missing data effectively?
This guide outlines a systematic approach to identifying, diagnosing, and resolving issues related to missing data in research workflows.
Step 1: Identify and Diagnose the Problem
naniar in R or missingno in Python.Step 2: Assess the Impact on Your Analysis
Step 3: Select and Apply a Handling Method The choice of method depends on the mechanism and amount of missing data. The table below compares common approaches.
Table: Methods for Handling Missing Data in Research
| Method | Best For | Key Advantage | Key Disadvantage |
|---|---|---|---|
| List-wise Deletion | MCAR data only [6] | Simple to implement | Can cause severe bias and loss of power if data not MCAR [7] |
| Single Imputation (Mean/Median) | Not generally recommended | Maintains dataset size | Underestimates variance and ignores uncertainty of imputed values [7] |
| Multiple Imputation | MAR data [6] [7] | Produces valid statistical inferences accounting for imputation uncertainty | Computationally intensive; requires careful implementation |
| Maximum Likelihood | MAR data [6] | Uses all available information without deleting cases | Requires specialized software and correct model specification |
Step 4: Validate and Document the Process
Prevention is the most effective strategy for handling missing data. Researchers should adopt the following practices [6]:
Table: Essential Reagents for Wildlife Disease Research & Data Integrity
| Reagent / Material | Critical Function | Data Integrity Consideration |
|---|---|---|
| Nucleic Acid Extraction Kits | Isolate DNA/RNA from diverse sample types (blood, swabs, tissue). | Consistent use and lot tracking are essential metadata for reproducible pathogen detection [1]. |
| PCR Master Mix | Amplifies target pathogen genetic material. | Using a pre-made master mix, rather than homemade solutions, reduces batch-to-batch variability and troubleshooting, improving data reliability [8]. |
| Positive & Negative Controls | Validate that diagnostic tests are working correctly. | Essential for distinguishing true negative results from test failures. Omitting these controls creates ambiguous, unusable data [8]. |
| Competent Cells | Enable cloning for pathogen characterization (e.g., sequencing). | Monitoring transformation efficiency ensures successful cloning and prevents data gaps in pathogen genetic sequence information [8]. |
Implementing a minimum data standard is a key proactive measure to ensure data completeness and reusability. The following workflow, based on a proposed standard for wildlife disease research, guides researchers in standardizing their data reporting [1].
1. What is the main limitation of using summarized data in wildlife disease research? Summarized data, often presented in summary tables, makes it impossible to disaggregate results back to the host level. This severely constrains secondary analysis, such as comparing disease prevalence across different populations, time periods, or species. Crucially, most studies only report positive detections, omitting negative results which are essential for understanding true disease dynamics and calculating accurate prevalence rates [1] [2].
2. What are disaggregated records, and why are they more powerful? Disaggregated records, or "tidy data," are structured so that each row corresponds to a single measurement—for example, the outcome of a diagnostic test for a single animal. This fine-scale, individual-level data, recorded at the finest possible spatial, temporal, and taxonomic scale, preserves the complete context of the sample. This format enables robust aggregation, complex analysis, and the reuse of data to test new ecological theories or track emerging threats [1].
3. How does a data standard help improve metadata collection? A data standard provides a common structure and set of properties for documenting datasets. Adopting a minimum data standard ensures that crucial metadata—such as sampling methods, host information, and diagnostic protocols—is collected and reported consistently. This harmonization makes datasets Findable, Accessible, Interoperable, and Reusable (FAIR), facilitating data sharing and integration across studies and disciplines [1] [2] [9].
4. What types of project data should use a wildlife disease data standard? This standard is suitable for studies involving wild animal samples examined for parasites (micro and macro). This includes the first report of a parasite in a species, mass mortality investigations, longitudinal multi-species sampling, screening during human disease outbreaks, and passive surveillance programs. It is not intended for environmental samples or free-living macroparasite data, which have their own dedicated standards [1].
5. How can researchers navigate safety concerns when sharing detailed data? The data standard includes guidance for secure data sharing, particularly for sensitive information like high-resolution location data of threatened species or dangerous zoonotic pathogens. Recommendations include data obfuscation techniques and context-aware sharing protocols to balance transparency with biosafety and prevent potential misuse [2].
Problem: Inability to compare or aggregate my dataset with others from published literature.
Problem: My dataset includes negative test results, but the journal only allows a summary table.
Problem: I am unsure what specific information to record during fieldwork and lab analysis.
The following tables summarize the quantitative aspects of a proposed minimum data standard for wildlife disease research, which directly addresses the limitations of summarized data by championing disaggregated records [1].
Table 1: Overview of the Minimum Data Standard Structure
| Category | Number of Fields | Number of Required Fields | Description |
|---|---|---|---|
| Core Data Fields | 40 | 9 | Documents the sample, host, and parasite/test result at the individual level. |
| Project Metadata Fields | 24 | 7 | Provides context about the entire project (e.g., objectives, investigators, funding). |
Table 2: Breakdown of Core Data Field Categories
| Core Data Category | Example Fields |
|---|---|
| Sample Data (11 fields) | Sample ID, Sample date, Latitude, Longitude, Diagnostic method |
| Host Organism Data (13 fields) | Host species, Animal ID, Sex, Age class, Life stage |
| Parasite/Test Data (16 fields) | Parasite species, Test result, Test target, GenBank accession, Primer sequences |
This protocol details the steps for applying the minimum data standard to a wildlife disease research project, from planning to data sharing.
1. Project Planning and Data Collection
2. Data Formatting and Validation
wddsWizard), to check that your dataset conforms to the standard's structure and required fields [1].3. Data Sharing and Preservation
README file and a data dictionary explaining the contents, structure, and any abbreviations used in your dataset to ensure it can be understood and reused by others [10] [11].Table 3: Essential Research Reagent Solutions and Materials
| Item | Function in Wildlife Disease Research |
|---|---|
| Standardized Data Template | A pre-formatted spreadsheet (.xlsx or .csv) that guides the consistent recording of all required and optional data fields, reducing errors during data entry [1]. |
| Data Dictionary | A structured document that defines and describes each data element in the dataset (e.g., data type, allowed values, unit of measurement), which is crucial for interoperability [10] [11]. |
| Validation Software | An R package or JSON Schema validator that checks a completed dataset for compliance with the data standard, ensuring quality and reusability before sharing [1]. |
| Controlled Vocabularies/Ontologies | Standardized lists of terms (e.g., from the Global Biodiversity Information Facility - GBIF) for fields like host species or diagnostic methods, which enhance data integration and discovery [1] [12]. |
The following diagram illustrates the logical workflow and decision process for standardizing wildlife disease data, moving from raw, problematic data to a FAIR, reusable resource.
Problem: Incomplete sample or host metadata prevents data aggregation and limits usefulness for secondary analysis and pandemic forecasting.
Diagnosis and Solutions:
| Problem Cause | Diagnosis Questions | Solution Steps | Real-World Consequence of Inaction |
|---|---|---|---|
| Missing Critical Host Information | Is the host species, age, sex, or health status documented? | 1. Consult taxonomic databases for accurate species identification. 2. Implement a standardized data capture form with required fields. 3. Use controlled vocabularies for life stage and sex [1]. | Inability to identify reservoir species or susceptible populations during an outbreak, delaying targeted control measures [1]. |
| Inadequate Spatial or Temporal Data | Are the GPS coordinates and collection date for each sample recorded? | 1. Record decimal degree coordinates for all samples. 2. Use ISO 8601 format for dates. 3. Document the finest possible spatial and temporal scale [1]. | Limits understanding of disease ecology and spread patterns, hampering the prediction of emerging disease hotspots [13] [1]. |
| Unclear Diagnostic Method | Is the specific diagnostic test and its protocol fully described? | 1. Report the exact test and target. 2. Provide primer sequences for PCR tests. 3. Include a citation for the method used [1]. | False positives/negatives go undetected, leading to inaccurate prevalence estimates and flawed risk assessments for drug and vaccine development [1]. |
| Failure to Report Negative Data | Are all test results, including negatives, shared? | 1. Structure data in a "tidy" format where each row is a test result. 2. Do not filter or summarize data before sharing. 3. Share disaggregated data to allow for re-analysis [1]. | Creates a biased understanding of pathogen true prevalence and distribution, misdirecting public health resources and research efforts [1]. |
Problem: Technical and perceptual barriers prevent researchers from formatting and sharing their metadata according to FAIR principles.
Diagnosis and Solutions:
| Barrier Category | Specific Challenge | Solution Steps | Real-World Consequence of Inaction |
|---|---|---|---|
| Technical & Standardization | Proliferation of multiple, non-universal standards [14]. | 1. For wildlife disease data, adopt the proposed minimum data standard [1]. 2. Use generalist repositories that support common schemas. 3. Leverage open-source tools for data validation [1] [14]. | Data siloing and inability to perform integrative meta-analyses across studies, slowing down the identification of global health threats [13] [14]. |
| Perceptual & Incentive | Lack of rewards and recognition for sharing data [14]. | 1. Choose journals and funders that mandate data sharing. 2. Publish your data as a formal "Data Note" or cite it with a DOI. 3. Highlight your FAIR data practices in grant applications [14]. | Wasted research funding on redundant data collection and a failure to build upon previous work, delaying drug discovery and diagnostic tool development. |
| Infrastructure & Personnel | Inadequate access to tools or trained data managers [14]. | 1. Utilize template files (.csv, .xlsx) provided by data standards [1]. 2. Advocate for institutional support for data management roles. 3. Explore automated metadata management solutions [15]. | Critical data remains inaccessible or "dark," losing value over time and becoming useless for rapid response during a novel pandemic [13]. |
Q1: What is the minimum set of metadata I must report for a wildlife disease study? A minimum reporting standard for wildlife disease data includes 40 core data fields and 24 metadata fields. The 9 required fields are Sample ID, Animal ID, Host species, Test ID, Test result, Test date, Latitude, Longitude, and Diagnostic method [1]. This ensures basic interoperability and reusability.
Q2: How does poor metadata directly impact pandemic preparedness? Incomplete metadata cripples secondary data analysis, which is vital for spotting emerging trends. For example, a study found sex-mislabeled samples in 46% of investigated transcriptomics studies, which can bias analysis and lead to incorrect conclusions about a pathogen's mechanism or host response [14]. During a fast-moving outbreak, such errors can misdirect public health interventions.
Q3: What should I do if I suspect I've discovered an emerging wildlife disease? Immediately coordinate with your State animal health official. For the U.S., presumptive or confirmed cases of notifiable diseases on the National List of Reportable Animal Diseases (NLRAD) must be reported within 24 hours [16]. An emerging disease is defined as a new agent or a known agent with a change in epidemiology, host range, or geography that poses a significant threat [16].
Q4: We use a pooled testing approach for wildlife samples. How can we format this data? The data standard accommodates pooled testing. If individual animals are not identified, leave the "Animal ID" field blank for the test record. If the pool consists of known individuals, the single test can be linked to multiple Animal ID values in your dataset [1]. The key is to transparently document the sampling method.
Q5: Are there specific standards for metadata in clinical trials that could be applied to wildlife research? Yes, the same principles apply. Clinical trials use standards like CDISC to ensure data from different sponsors and studies can be integrated. The challenge in wildlife research is similar: adapting to diverse client or project requirements. The strategic use of metadata is key to automating workflows and ensuring traceability from sample to result, whether in drug development or pathogen surveillance [15].
| Item | Function in Wildlife Disease Research | Application in Metadata Context |
|---|---|---|
| Standardized Sampling Kits | Pre-packaged kits for consistent collection of oral/rectal swabs, blood, and tissue. | Ensures base-level consistency across samples and field teams, reducing a major source of metadata variability [1]. |
| Controlled Vocabularies & Ontologies | Standardized lists of terms for fields like host species, sex, and life stage. | Critical for making data interoperable; allows machines and researchers to accurately merge datasets from different studies [1] [14]. |
Data Validation Software (e.g., R package wddsWizard) |
Tools that check a dataset against a metadata standard's schema for errors. | Automates quality control before data submission, catching formatting and completeness issues that would otherwise hinder re-use [1]. |
| Generalist Data Repositories (e.g., Zenodo) | Platforms for publishing and preserving any type of research data with a DOI. | Provides a findable, accessible, and citable home for datasets, fulfilling the "F" and "A" of FAIR principles when specialist platforms are not available [1]. |
| Electronic Field Data Capture Apps | Mobile applications for recording data directly into structured digital forms. | Minimizes transcription errors and ensures spatial (GPS) and temporal data are automatically and accurately captured at the source [1]. |
This technical support center provides guidance for researchers, scientists, and drug development professionals on implementing the new minimum data standard for wildlife disease research. This framework is designed to improve the quality, transparency, and reusability of data critical for ecological health and pandemic preparedness [2].
Q1: What is the purpose of this new data standard? This standard provides a unified framework for reporting wildlife disease data. It addresses the critical issue of fragmented and inconsistent data by specifying a common set of data and metadata fields. This ensures data is Findable, Accessible, Interoperable, and Reusable (FAIR), which enhances our ability to detect and respond to emerging zoonotic threats [2] [1].
Q2: My study only uses PCR. Do I need to fill out fields related to ELISA? No. The standard is designed to be flexible. Researchers should only populate the fields relevant to their specific diagnostic methods. For instance, if you use PCR, you would fill out fields like "Forward primer sequence" and "Gene target," but can leave ELISA-specific fields like "Probe target" blank [1].
Q3: Why does the standard require reporting negative test results? Including negative results is essential for accurately calculating disease prevalence. When only positive detections are reported, it is impossible to compare infection rates across different populations, time periods, or species. The standard mandates consistent documentation of negatives to enable more robust and reproducible secondary analysis [2] [1].
Q4: How should I handle sensitive data, like precise locations of endangered species? The standard includes detailed guidance for secure data sharing. It recommends obfuscating high-resolution location data (e.g., by reporting coordinates at a less precise scale) to balance transparency with biosafety and conservation ethics. These safeguards help prevent potential misuse of sensitive information [2].
Q5: Where should I deposit my data once it's formatted to this standard? The standard is designed for compatibility with both generalist and specialist repositories. Researchers are encouraged to deposit their datasets in open-access repositories such as Zenodo, the Global Biodiversity Information Facility (GBIF), or dedicated platforms like the Pathogen Harmonized Observatory (PHAROS) database [2] [1].
The minimum data standard comprises 40 core data fields organized into three categories. Only 9 of these fields are mandatory for all studies [1].
These 11 fields describe the sample itself and the context of its collection [1].
| Variable | Type | Required | Descriptor |
|---|---|---|---|
| Sample ID | String | ✓ | A researcher-generated unique ID for the sample (e.g., "OS BZ19-114") [17]. |
| Animal ID | String | A unique ID for the individual animal. Can be blank for pooled samples [17]. | |
| Sampling date | Date | ✓ | The date of sample collection [1]. |
| Latitude | Number | ✓ | Decimal degrees of the sampling location [1]. |
| Longitude | Number | ✓ | Decimal degrees of the sampling location [1]. |
| Location uncertainty | Number | The uncertainty of the location in meters [1]. | |
| Sample type | String | ✓ | The type of sample collected (e.g., "oral swab," "blood," "feces") [1]. |
| Sampling method | String | The technique used to collect the sample [1]. | |
| Sample storage | String | How the sample was preserved post-collection [1]. | |
| Pooled | Boolean | Whether the sample is a pool from multiple animals [1]. | |
| Pool ID | String | An identifier for the pool, if applicable [1]. |
These 13 fields provide details about the animal from which the sample was taken [1].
| Variable | Type | Required | Descriptor |
|---|---|---|---|
| Host identification | String | ✓ | The species binomial name (e.g., "Odocoileus virginianus") [17]. |
| Organism sex | String | The sex of the individual animal [17]. | |
| Live capture | Boolean | Whether the animal was alive at capture [17]. | |
| Host life stage | String | The life stage of the animal (e.g., "juvenile," "adult") [17]. | |
| Age | Number | The numeric age of the animal at sampling [17]. | |
| Age units | String | The units for age (e.g., "years") [17]. | |
| Mass | Number | The mass of the animal at collection [17]. | |
| Mass units | String | The units for mass (e.g., "kg") [17]. | |
| Length | Number | The numeric length of the animal [17]. | |
| Length measurement | String | The axis of measurement (e.g., "snout-vent length") [17]. | |
| Length units | String | The units for length (e.g., "meters") [17]. | |
| Organism quantity | Number | A number for the quantity of organisms [17]. | |
| Organism quantity units | String | The units for organism quantity (e.g., "individuals") [17]. |
These 16 fields document the diagnostic methods and results [1].
| Variable | Type | Required | Descriptor |
|---|---|---|---|
| Pathogen tested for | String | ✓ | The parasite/pathogen targeted in the test [1]. |
| Diagnostic method | String | ✓ | The technique used (e.g., "PCR," "ELISA," "culture") [1]. |
| Test result | String | ✓ | The outcome of the test (e.g., "positive," "negative") [1]. |
| Test ID | String | A unique identifier for the specific test run [1]. | |
| Test date | Date | The date the diagnostic test was performed [1]. | |
| Pathogen identified | String | The identity of the detected parasite, if any [1]. | |
| GenBank accession | String | Accession number for submitted genetic sequence data [1]. | |
| Ct value | Number | The cycle threshold value from PCR tests [1]. | |
| Forward primer sequence | String | The forward primer sequence (for PCR methods) [1]. | |
| Reverse primer sequence | String | The reverse primer sequence (for PCR methods) [1]. | |
| Gene target | String | The gene targeted by the assay (for PCR methods) [1]. | |
| Primer citation | String | A citation for the primers used [1]. | |
| Probe target | String | The target of the probe (for ELISA methods) [1]. | |
| Probe type | String | The type of probe used (for ELISA methods) [1]. | |
| Probe citation | String | A citation for the probe used [1]. | |
| Test accuracy | Number | A measure of test accuracy (e.g., sensitivity, specificity) [1]. |
To fully document a dataset, the standard also includes 24 metadata fields, 7 of which are required. This project-level information provides essential context [1].
| Metadata Field | Required | Description |
|---|---|---|
| Title | ✓ | A descriptive name for the dataset [1]. |
| Creator | ✓ | The main researchers involved, with ORCIDs [1]. |
| Publisher | ✓ | The entity making the data available [1]. |
| Publication Year | ✓ | The year the dataset is published [1]. |
| Resource Type | ✓ | The nature of the resource (e.g., "Dataset") [1]. |
| License | ✓ | The license under which the data is shared [1]. |
| Abstract | ✓ | A free-text summary of the project and dataset [1]. |
| Item | Function |
|---|---|
| Standardized Template Files | Pre-formatted .csv and .xlsx files available on GitHub ensure researchers start with the correct data structure [1]. |
| Data Validation Package | A dedicated R package ("wddsWizard") provides convenience functions to check that data conforms to the standard before sharing [1]. |
| JSON Schema | A machine-readable schema that formally defines the standard's structure, enabling automated validation and tool development [1]. |
| Controlled Vocabularies | Recommended ontologies and standard terms for fields like "Host life stage" and "Sample type" to improve consistency [1]. |
The following diagram illustrates the recommended process for preparing a wildlife disease dataset using the new standard.
Diagram: Data Standardization Workflow
What is the purpose of this minimum data standard? Rapid and comprehensive data sharing is vital for transparent and actionable wildlife infectious disease research and surveillance. This standard provides a common framework to ensure datasets are Findable, Accessible, Interoperable, and Reusable (FAIR), facilitating the sharing and aggregation of data from disparate studies [1].
When should I use this data standard? This standard is suitable for studies involving wild animal samples examined for parasites. Applicable project types include the first report of a parasite in a wildlife species, investigation of mass wildlife mortality events, longitudinal multi-species sampling, and passive surveillance programs [1].
What are the most common mistakes when formatting data? A frequent error is sharing data only in a summarized format or reporting only positive results. The standard requires data to be shared as disaggregated records at the finest possible spatial, temporal, and taxonomic scale. Another common issue is omitting critical metadata about sampling effort or host-level information [1].
How do I report negative test results?
All diagnostic test outcomes, including negative results, should be reported as individual records. For negative results, the fields related to parasite identification (e.g., parasite_taxon_id) are left blank, but all host, sample, and testing method fields must be completed [1].
Problem: You conducted a single test on a sample pool containing material from several host animals, making it difficult to assign results to a single animal_id.
Solution:
animal_id blank: If animals are not individually identified, the animal_id field can be left empty for that record [1].sample_processing or notes field.Problem: You are unsure how specific the host or parasite identification needs to be.
Solution:
Problem: A tool in your analysis pipeline fails due to incompatible input files, a common challenge in bioinformatics workflows [18].
Solution:
job.err.log file for specific error messages that can diagnose compatibility issues [18].The minimum data standard identifies 40 core data fields. The following tables summarize the nine required fields and provide examples of other essential fields for sampling, host, and parasite information [1].
All nine of these fields must be populated in every dataset that uses this standard [1].
| Field Name | Field Category | Description | Example |
|---|---|---|---|
sample_id |
Sample | A unique identifier for the sample. | BZ19-114-O |
test_id |
Parasite | A unique identifier for the specific diagnostic test. | PCR_BZ19-114-O |
test_result |
Parasite | The outcome of the diagnostic test. | positive; negative; inconclusive |
test_target |
Parasite | The parasite taxon or group the test was designed to detect. | Alphacoronavirus |
test_name |
Parasite | The name of the diagnostic method used. | conventional PCR |
host_taxon_id |
Host | A unique identifier from a taxonomic authority (e.g., NCBI). | 44394 |
host_taxon_name |
Host | The scientific name of the host species. | Desmodus rotundus |
collection_date |
Sample | The date the sample was collected. | 2019-03-17 |
location_region |
Sample | The name of the region, state, or province where the sample was collected. | Cayo District |
Beyond the required fields, these additional fields provide critical context for the sample and host [1].
| Field Name | Category | Required? | Description | Example |
|---|---|---|---|---|
sample_type |
Sample | No | The type of material collected. | oral swab; rectal swab; blood; tissue |
sample_processing |
Sample | No | Methods used to process the sample before testing. | homogenized; pooled; filtered |
animal_id |
Host | No | A unique identifier for the individual host animal. | BZ19-114 |
host_life_stage |
Host | No | The age class or life stage of the host. | adult; juvenile; subadult |
host_sex |
Host | No | The sex of the host animal. | female; male; unknown |
location_lat |
Sample | No | The decimal latitude of the sampling location. | 17.0987 |
location_lon |
Sample | No | The decimal longitude of the sampling location. | -88.9410 |
These fields detail the testing methodology and results, which are crucial for interpreting findings [1].
| Field Name | Category | Required? | Description | Example |
|---|---|---|---|---|
parasite_taxon_id |
Parasite | Conditional | Taxonomic identifier for the detected parasite; required if test_result is positive. |
693995 |
parasite_taxon_name |
Parasite | Conditional | Scientific name of the parasite; required for positive results. | Alphacoronavirus 1 |
gene_target |
Parasite | No | The specific gene targeted by the assay (e.g., for PCR). | RNA-dependent RNA polymerase (RdRp) gene |
forward_primer |
Parasite | No | The forward primer sequence used in a PCR assay. | CGGTGGGACTGATCAGAACC |
reverse_primer |
Parasite | No | The reverse primer sequence used in a PCR assay. | CARATYGGHCCRCARCANGG |
primer_citation |
Parasite | No | A publication or protocol describing the primers and assay. | doi:10.1016/j.virol.2019.12.001 |
Background: Non-invasive scat collection is a valuable method for studying parasites in elusive or protected wild carnivores, minimizing animal stress and enabling broader spatial monitoring [19].
Key Features:
Materials and Reagents:
Procedure:
location_lat, location_lon) and date (collection_date) [1].host_taxon_name) [19].Sample Preservation:
Host Identification:
Parasite Detection:
Result Interpretation:
test_result confirms the presence of the test_target parasite in the host population.General Notes and Troubleshooting:
Data Standard Core Components
Wildlife Disease Data Workflow
This table details key reagents and materials used in the collection, processing, and analysis of wildlife disease samples, as derived from the reviewed protocols [1] [19].
| Item | Function/Application | Protocol Specifics |
|---|---|---|
| Ethanol (70% & 90%) | Sample preservation for morphological (70%) and molecular (90%) analysis. | Used for non-invasive fecal sample preservation; 90% ethanol is preferred for DNA work [19]. |
| Silica Gel Beads | Desiccant for DNA preservation in non-invasive samples. | An alternative to ethanol for preserving scat samples for subsequent molecular host or parasite identification [19]. |
| Specific Primers | Target amplification in PCR-based parasite detection. | Sequences defined in forward_primer and reverse_primer fields; citation provided in primer_citation [1]. |
| Phosphate-Buffered Saline (PBS) | Relaxation and storage of fresh helminths. | Prevents contraction of muscle fibers in worms, allowing for accurate taxonomic identification [19]. |
| GPS Unit | Geotagging sample collection locations. | Provides decimal latitude (location_lat) and longitude (location_lon) for the sampling event [1]. |
Q1: What types of research projects is this data standard designed for? This data standard is designed for studies involving wild animal samples examined for parasites (including viruses, bacteria, and macroparasites). Suitable project types include [1]:
Q2: Why is it so important to include negative data and detailed metadata? Most published datasets only report summary tables or positive detections, which severely constrains secondary analysis [2]. Including negative results and rich contextual metadata enables more rigorous comparisons of disease prevalence across time, geography, and host species, making the data truly reusable and actionable for global health security [1] [2].
Q3: My study uses a pooled testing approach (e.g., pooling samples from multiple animals). How can I apply this standard? The standard is flexible enough to accommodate pooled testing [1]. In cases where animals are not individually identified, you can leave the "Animal ID" field blank. If the individuals in the pool are known, you can link the single test result to multiple Animal ID values.
Q4: How should I handle sensitive data, like precise locations of endangered species? The standard includes detailed guidance for secure data obfuscation [2]. It is crucial to balance transparency with biosafety and conservation ethics. Best practices involve generalizing sensitive data (e.g., reducing coordinate precision) rather than deleting it, and thoroughly documenting the reasons and methods for restriction in the metadata [20].
Q5: Where should I deposit my formatted and validated data? You should make your data available in a findable, open-access generalist repository (e.g., Zenodo) and/or a specialist platform like the Pathogen Harmonized Observatory (PHAROS) database [1].
Problem: A researcher is unsure if their wildlife disease surveillance data meets the basic criteria for using the standard.
Solution: Confirm your dataset aligns with the core purpose of the standard by answering these questions [1]:
Problem: A user is confused about which of the 40 data fields they must populate.
Solution: The standard defines 9 required fields. Beyond that, your study design and methods determine which other fields are conditionally required or optional [1]. For example, fields for PCR primer sequences are not applicable for an ELISA-based study.
Solution Table: Minimum Data Fields Overview
| Category | Field Name | Requirement Level | Notes |
|---|---|---|---|
| Project | Project ID | Required | Unique identifier for the project. |
| Sample | Sample ID | Required | Unique identifier for the sample. |
| Sample | Sample matrix | Required | e.g., blood, oral swab, tissue. |
| Sample | Sample date | Required | Date of collection. |
| Host | Host species | Required | Ideally from a controlled vocabulary. |
| Host | Host life stage | Conditionally Required | If collected. |
| Host | Host sex | Conditionally Required | If collected. |
| Parasite | Pathogen detected | Required | "Yes" or "No". |
| Parasite | Pathogen name | Conditionally Required | Required if Pathogen detected is "Yes". |
| Parasite | Diagnostic method | Required | e.g., PCR, ELISA, microscopy. |
| Parasite | Gene target | Conditionally Required | Required for molecular methods like PCR. |
| Parasite | Primer citation | Conditionally Required | Required for non-standard assays. |
Problem: Data is structured in a summary format or wide table, making it non-interoperable.
Solution: Adopt a "tidy data" or "rectangular data" format [1]. The key is to structure your data so each row represents a single diagnostic test outcome. This format is machine-readable and ideal for analysis and aggregation.
The workflow below illustrates the five-step process for implementing the wildlife disease data standard:
Problem: A researcher wants to check for errors before submitting their dataset to a repository.
Solution: Use the validation tools provided by the standard's developers [1]:
wddsWizard), available on GitHub, with convenience functions to validate your data and metadata against the JSON Schema.
Running these tools will help catch formatting errors or missing required fields, ensuring a smooth submission process.| Tool / Resource Name | Function | Access / Link |
|---|---|---|
| Template Files | Pre-formatted .csv and .xlsx files with the correct column headers. | Available in the supplement of the main paper and from GitHub: github.com/viralemergence/wdds [1]. |
| Validation Tools (R package) | Checks data and metadata for compliance with the standard. | GitHub: github.com/viralemergence/wddsWizard [1]. |
| JSON Schema | A machine-readable definition of the standard for advanced validation. | Available via the standard's repositories [1]. |
| PHAROS Database | A dedicated specialist platform for sharing and discovering wildlife disease data. | pharos.viralemergence.org [1]. |
| Controlled Vocabularies | Recommended ontologies for fields like host species and sample matrix. | See Supporting Information of the main paper for links [1]. |
Why is my wildlife disease data difficult for others to use or combine with other datasets? This is often due to a lack of standardization. When researchers use different formats, terminology, and structures for their data, it becomes challenging to aggregate or compare datasets. Adopting a common data standard ensures that key information is documented consistently, making data interoperable [2].
What is the most critical piece of missing information that hinders data re-use? Negative data—records of tests that did not detect a pathogen—are often omitted [1] [2]. Without this information, it is impossible to calculate accurate disease prevalence or understand the true distribution of a pathogen. A best practice is to share all results, both positive and negative, in a disaggregated format [1].
Which data fields are essential to include for my data to be reusable? A minimum standard for wildlife disease data has been proposed, outlining 40 core data fields. While your study may not use all of them, the nine required fields form the essential foundation for data re-usability [1] [2]. These are listed in the table below.
How should I format and store my data files for long-term use? Data should be saved in open, non-proprietary file formats like .csv (comma-separated values) to ensure they remain machine-readable in the future [1] [21]. Your data should be structured in a "tidy" or "rectangular" format, where each row represents a single observation (e.g., one diagnostic test) and each column represents a variable [1].
The following table summarizes the required fields in the minimum data standard, which is designed to make datasets Findable, Accessible, Interoperable, and Reusable (FAIR) [2].
Table: Required Data Fields for Wildlife Disease Studies [1]
| Field Name | Category | Description |
|---|---|---|
| Animal ID | Host Organism | A unique identifier for the host animal. |
| Host species name | Host Organism | The taxonomic name of the host species. |
| Sample ID | Sample | A unique identifier for the sample. |
| Sample material | Sample | The type of sample collected (e.g., blood, swab). |
| Diagnostic test name | Parasite | The name of the test used (e.g., PCR, ELISA). |
| Test result | Parasite | The outcome of the test (e.g., positive, negative). |
| Test date | Sample | The date the sample was collected or tested. |
| Location name | Sample | The name of the sampling location. |
| Latitude | Sample | The decimal latitude of the sampling location. |
| Longitude | Sample | The decimal longitude of the sampling location. |
This methodology provides a step-by-step guide for formatting a wildlife disease dataset according to the minimum data standard [1].
1. Assess and Tailor the Standard
2. Structure and Format the Data
3. Document Project Metadata Project-level metadata provides the essential context for your dataset. Ensure you document the following [1] [21]:
4. Validate and Share the Data
wddsWizard, to check that your dataset conforms to the standard [1].The following diagram illustrates the key steps a researcher should take to format a dataset for re-use, from initial data collection to final publication in a repository.
Table: Essential Resources for Standardized Data Management
| Tool / Resource | Function | Use Case |
|---|---|---|
| Minimum Data Standard [1] | Provides a checklist of required and optional data fields. | Ensuring your dataset contains all necessary information for re-use and interoperability. |
| Template Files (.csv, .xlsx) [1] | Pre-formatted, empty tables from the standard's developers. | Jump-starting data entry in the correct format. |
| JSON Schema / R Package (wddsWizard) [1] | A machine-readable rule set and validation tool. | Programmatically checking your dataset for errors before publication. |
| FAIR Principles [21] | A set of guiding principles for modern data management. | Making data Findable, Accessible, Interoperable, and Reusable. |
| Open Data Repositories (e.g., Zenodo, PHAROS) [1] | A platform for preserving and publishing research data. | Sharing your formatted data with the global research community to ensure long-term access. |
Q1: What are the common causes of poor-quality wildlife disease data in a research repository, and how can they be fixed? Poor data quality often stems from inconsistent collection procedures, non-standardized metadata, and lack of validation. Solutions include:
Q2: My team uses different data formats (e.g., CSV, Excel, direct from lab equipment). How can we standardize this for a unified wildlife disease database? A multi-pronged approach is needed:
Q3: Are there open-source validation packages for checking wildlife disease genomic data? Yes, the open-source community provides robust options. When selecting a package, consider the following criteria, as exemplified by the MultiModalGraphics R package [26]:
| Package Name | Language | Primary Function | Key Feature for Wildlife Data |
|---|---|---|---|
| MultiModalGraphics [26] | R | Statistical visualization & integration | Embeds statistical annotations (p-values, q-values) directly onto plots for transparent reporting. |
| SeleniumBase (for Web Tools) [23] | Python | Automated testing of web-based tools | Validates data upload, analysis output, and visualization accuracy in biomedical web applications. |
| Bioconductor Ecosystem (e.g., MultiAssayExperiment) [26] | R | Integrated genomic data analysis | Manages and integrates multi-omics data from diverse sources, crucial for understanding disease pathogenesis. |
Q4: How can we ensure our data collection tools are working correctly before deploying them in the field? Robust testing is essential.
Issue: Inconsistent or Missing Metadata in Wildlife Disease Samples This is a primary challenge that hindes data reuse and integration [22].
collection_date or location_gps.Issue: Failure to Replicate a Bioinformatics Analysis from a GitHub Repository This often occurs due to environmental differences and a lack of computational provenance.
Dockerfile or similar container configuration in the repository. Building and running the analysis within this container guarantees an identical environment.requirements.txt (for Python) or DESCRIPTION (for R) to recreate the required package versions.The following methodology is adapted from a 2023 survey of pathogenic Escherichia coli in wildlife on the Qinghai-Xizang Plateau [27].
1. Objective To isolate, identify, and genetically characterize pathogenic E. coli strains from the fecal samples of wild animals.
2. Materials (Research Reagent Solutions) Key materials and their functions in this experimental context are listed below.
| Item | Function / Rationale |
|---|---|
| CHROMagar E. coli Coliform Chromogenic Medium | Selective culture medium for the specific isolation and preliminary identification of E. coli based on colony color [27]. |
| Polymerase Chain Reaction (PCR) Reagents | For the targeted amplification of specific bacterial virulence genes (e.g., stx, eae, hlyA, astA, fim) from the isolated bacterial colonies [27]. |
| Whole-Genome Sequencing (WGS) Kits | For comprehensive genomic analysis of representative isolates to confirm pathogen type, identify phylogenomic group (e.g., A, B1, B2), and study virulence factors in detail [27]. |
| Microbial Enrichment Broth | A non-selective broth used to increase the concentration of E. coli in the sample before plating on selective media, improving the detection sensitivity [27]. |
3. Step-by-Step Methodology
| Analysis Metric | Result (n=60 E. coli isolates) |
|---|---|
| Isolates classified into pathogenic types | 46/60 (76.7%) |
| Hybrid pathovars (multiple virulence genes) | 33/60 (55.0%) |
| Predominant Phylogenetic Group | B1 (42/60, 70.0%) |
fim gene (adhesion) prevalence |
60/60 (100.0%) |
stx (Shiga toxin) gene prevalence |
14/60 (23.3%) |
kpsD gene prevalence |
17/60 (28.3%) |
eae (intimin) gene prevalence |
3/60 (5.0%) |
FAQ 1: What is the core difference between landscape-scale and targeted surveillance, and why is combining them so challenging? Landscape-scale monitoring is conducted over large areas to provide spatial data and answer where and when ecosystem change is occurring. In contrast, targeted monitoring is designed around testable hypotheses over defined areas to determine the causes of ecosystem change [28] [29]. The primary logistical challenge in combining them is the trade-off between space, time, and information content. Landscape methods cover vast areas but lack detail, while targeted methods provide deep causal insights but at a local scale, making integration complex and resource-intensive [28].
FAQ 2: Our targeted surveillance for wildlife disease is yielding inconsistent results. What is the most common metadata oversight? The most common oversight is the failure to report and document negative test results and adequate contextual metadata [1] [2]. Many studies only report data in a summarized format or share individual-level data only for positive results. This makes it impossible to accurately compare disease prevalence across populations, years, or species or to understand true disease dynamics [1]. Adopting a minimum data standard that mandates this information is crucial.
FAQ 3: How can we improve the accuracy of wildlife classification when image quality from camera traps is poor? Integrating specific metadata with your image data can significantly enhance classification performance, especially when visual data is suboptimal. A novel approach shows that using metadata such as temperature, location, and time alongside images can boost accuracy. Notably, this method can achieve high accuracy with metadata-only classification, thereby reducing reliance on image quality [30].
FAQ 4: What are the key required fields for a wildlife disease dataset to be globally interoperable? A proposed minimum data standard identifies 40 core data fields, of which 9 are considered essential. These required fields span sample, host, and parasite data categories to ensure the dataset is Findable, Accessible, Interoperable, and Reusable (FAIR) [1] [2].
Table 1: Minimum Required Data Fields for Wildlife Disease Reporting
| Category | Required Field Name | Description |
|---|---|---|
| Sample | Sample ID | Unique identifier for the sample [1]. |
| Sample | Sample date | Date when the sample was collected [1]. |
| Sample | Latitude | Latitude in decimal degrees [1]. |
| Sample | Longitude | Longitude in decimal degrees [1]. |
| Host | Host species | Scientific name (binomial) of the host organism [1]. |
| Parasite | Pathogen taxon name | Name of the parasite/pathogen detected [1]. |
| Parasite | Diagnostic method | Name of the test used (e.g., PCR, ELISA) [1]. |
| Parasite | Test result | Outcome of the diagnostic test (e.g., positive, negative) [1]. |
| Parasite | Test ID | Unique identifier for the test instance [1]. |
Problem: Your landscape-scale surveillance has detected a change in pathogen prevalence, but your data cannot reveal why the change is happening.
Solution: Integrate a targeted monitoring component to test specific hypotheses about drivers [28] [29].
Table 2: Protocol for Linking Landscape Detection to Targeted Investigation
| Step | Action | Protocol Detail | Key Output |
|---|---|---|---|
| 1 | Analyze Landscape Data | Use spatial and temporal data from landscape monitoring to identify a specific hotspot or a significant change in prevalence [28]. | A focused, testable hypothesis (e.g., "Prevalence of Virus X is higher in fragmented forest patches due to host density"). |
| 2 | Design Targeted Study | Establish sites within and outside the identified hotspot. Standardize methods to collect a broad suite of variables related to the hypothesis (e.g., host density, vegetation structure, climate data) [29]. | A causal model linking an environmental driver to the disease outcome. |
| 3 | Collect & Fuse Data | Implement the targeted sampling design. Ensure all data collected adheres to the minimum data standard, including negative results and full metadata [1]. | A disaggregated dataset that can be directly linked to the broader landscape data for integrated analysis. |
Problem: Data from different research groups or surveillance scales cannot be easily combined or understood, limiting its re-use and value for global health security [2].
Solution: Adopt and implement a minimum data standard for all wildlife disease research and surveillance activities [1].
Step-by-Step Resolution:
wddsWizard from GitHub) to validate your data and metadata against the standard before sharing [1].Problem: Automated classification of species from camera traps or other image sources is unreliable due to poor angles, lighting, or low image quality.
Solution: Augment your deep learning models with relevant metadata to improve performance and reduce dependence on image quality [30].
Experimental Protocol: Metadata-Augmented Classification
Table 3: Key Reagents and Solutions for Wildlife Disease Surveillance
| Item | Function/Application |
|---|---|
| Standardized Sampling Kits | Pre-packaged kits for consistent collection of oral/rectal swabs, blood, and tissue samples across multiple field teams, ensuring data comparability. |
| Diagnostic Primers & Probes | Specific oligonucleotides for PCR-based pathogen detection (e.g., coronavirus screening). The "Primer citation" field must be completed in the data standard [1]. |
| GPS Data Loggers | For precise recording of sampling location (latitude/longitude), a required field in minimum data standards [1]. |
| Temperature Data Loggers | To collect ambient temperature metadata, which can be fused with image data to improve wildlife classification models [30]. |
Data Validation Software (e.g., wddsWizard R package) |
A tool to check dataset compliance with the minimum data standard before submission to repositories, ensuring data quality and interoperability [1]. |
Problem: Error when submitting dataset to repository due to missing required metadata fields.
Problem: Security warning when handling location data for threatened species.
Problem: Inability to merge or compare datasets from different research groups.
Problem: Dataset is rejected for being "non-machine-readable."
Q1: Why is it important to include negative test results in shared wildlife disease data? Including negative results is crucial for accurately calculating disease prevalence, understanding pathogen distribution, and identifying true disease-free populations. Most published datasets only report positive detections or provide summarized data, which severely constrains secondary analysis and meta-analyses [1] [2].
Q2: How can we balance data transparency with the security risks of sharing precise location data? The balance is achieved through:
Q3: What are the most common mistakes that make data non-FAIR (Findable, Accessible, Interoperable, and Reusable)? Common mistakes include:
Q4: Our study uses a pooled testing method. How do we apply the minimum data standard? The standard is flexible enough for pooled testing. In such cases:
Animal ID field can be left blank if individuals are not identified [1].Sample ID field is critical and must uniquely identify the pooled sample.PooledSampleSize field should be used to record the number of individual samples within the pool [1].This table summarizes the nine required fields as per the minimum data standard for wildlife disease research [1].
| Field Name | Data Type | Description | Example Entry |
|---|---|---|---|
| Animal ID | Text | A unique identifier for the host animal. | BZ19-114 |
| Sample ID | Text | A unique identifier for the biological sample. | BZ19-114_oral |
| Host Species | Text | The taxonomic identification of the host. | Desmodus rotundus |
| Observation Date | Date | The date the sample was collected. | 2019-03-15 |
| Latitude | Number | Decimal latitude of sampling location. | 17.2534 |
| Longitude | Number | Decimal longitude of sampling location. | -88.7711 |
| Diagnostic Method | Text | The technique used for pathogen detection. | PCR, ELISA, metagenomics |
| Test Result | Text | The outcome of the diagnostic test. | Positive, Negative, Inconclusive |
| Pathogen | Text | The taxonomic identification of the detected parasite/pathogen. | Alphacoronavirus |
This table synthesizes key practices for managing sensitive research data, drawing from general data privacy principles [31] [32] and wildlife-specific guidance [2].
| Practice | Description | Application in Wildlife Research |
|---|---|---|
| Data Minimization | Collect only the data that is absolutely necessary. | Collect only essential fields mandated by the minimum standard; avoid over-collection of redundant location details [32]. |
| Encryption | Protect sensitive data both at rest and in transit. | Encrypt dataset files before sharing and use repositories that support encrypted transfers [31]. |
| Access Controls | Restrict data access to only authorized individuals. | Use tiered-access models in data repositories to control who can view sensitive location data [31] [2]. |
| Data De-identification/Obfuscation | Remove or generalize identifying information. | Generalize precise GPS coordinates to a lower resolution (e.g., to the county level) to protect threatened species [2]. |
| Regular Audits | Conduct periodic reviews of data access and security. | Audit who has accessed restricted datasets and review data sharing agreements with partners [31] [32]. |
This protocol is adapted from a national-scale surveillance study for SARS-CoV-2 in free-ranging deer, which combines cohort and cross-sectional sampling [33].
1. Objective Definition Define the primary objective, such as understanding the mechanisms and risk factors of pathogen transmission, evolution, and persistence in wildlife populations across a broad geographical scale [33].
2. Research Network Building Leverage partnerships between state/federal public service sectors and academic researchers. An interdisciplinary network is critical for securing land access, animal capture, and standardized sampling across multiple sites [33].
3. Sampling Design: Integrating Cohort and Cross-Sectional Methods
4. Data Collection and Standardization
5. Data Sharing and Management
| Item | Function in Wildlife Disease Research |
|---|---|
| Minimum Data Standard Template | A pre-formatted spreadsheet (.csv or .xlsx) that provides the correct structure for collecting and sharing wildlife disease data, ensuring compliance with reporting standards [1]. |
| Data Validation Toolbox | A suite of tools (e.g., a JSON Schema or a dedicated R package) used to check a dataset's compliance with the minimum data standard before submission to a repository [1]. |
| Persistent Identifier Services | Services that provide Digital Object Identifiers (DOIs) for datasets and ORCID iDs for researchers, making data findable and ensuring proper attribution [2]. |
| Open-Access Repository | A digital platform (e.g., Zenodo, GBIF, or specialized platforms like PHAROS) for archiving and publicly sharing research data in a FAIR manner [1] [2]. |
| Color Contrast Checker | An online tool that calculates the contrast ratio between foreground (e.g., text) and background colors, ensuring visualizations are accessible to those with low vision or color vision deficiencies [34] [35]. |
Within the framework of improving metadata collection for wildlife disease research, adaptive sampling designs have emerged as a critical methodology for enhancing data quality and cost-efficiency. Traditional time-based sampling strategies often lead to significant data challenges, including data redundancy and data loss, which can compromise the accuracy of disease models and resource allocation [36]. This technical support center provides researchers, scientists, and drug development professionals with practical guides and solutions for implementing these sophisticated sampling strategies in their own wildlife disease monitoring programs.
Answer: Adaptive sampling is a strategy that dynamically adjusts the segment interval between data samples based on the current condition of the system being monitored, unlike traditional time-based sampling which uses a fixed interval [36]. This approach is superior because it directly addresses two fundamental data problems:
Answer: Adaptive sampling strategies can be categorized based on how they adjust the sampling interval. The following table summarizes the primary types, their benefits, and their challenges [36]:
Table 1: Comparison of Adaptive Sampling Strategies
| Strategy Type | Key Principle | Benefits | Challenges |
|---|---|---|---|
| Step-Fixed IIS | Increases or decreases the interval in set steps in response to condition changes [36]. | Adaptable to changing conditions [36]. | Cannot cope effectively with large, rapid condition changes [36]. |
| Scale-Fixed IIS | Adjusts the interval multiplicatively (e.g., doubles or halves it) [36]. | Responds quickly to large condition changes [36]. | Sampling "gaps" caused by stepwise adjustment can be an obstacle to ideal sampling [36]. |
| Logical Function-Based IIS (LFBIIS) | Uses a logically correct function to create a continuous relationship between condition and interval [36]. | Continuous adjustment without sampling gaps [36]. | The adjustment is qualitative and may contain principle errors, as a precise function is hard to find [36]. |
Answer: Model instability across different datasets often indicates that your sample size is insufficient for the model to converge to a reliable state. You can resolve this by employing a learning curve analysis framework [37].
Experimental Protocol: Learning Curve Analysis for Data Size Determination This methodology helps you heuristically analyze the relationship between data size and model accuracy to determine a sufficiently large and reliable dataset [37].
S to ensure statistical robustness [37].n in S, and for each repetition, randomly draw a subset of size n from your full data pool D. Train your model on this subset and record its accuracy on a test set [37].
Problem: When using a step-fixed or scale-fixed adaptive sampling strategy, the gaps between interval steps mean I might miss the ideal sampling moment during a rapid disease escalation [36].
Solution:
Problem: The process of repeatedly training models on different data subsets to optimize the sampling design is computationally expensive and slow.
Solution:
Table 2: Essential Components for an Adaptive Sampling Research Framework
| Item / Solution | Function in the Context of Adaptive Sampling |
|---|---|
| Gaussian Process (GP) Model | A flexible surrogate model used to approximate complex system behaviors (e.g., disease spread). Its key advantage is providing an analytical estimate of prediction uncertainty, which can directly guide where to sample next [38]. |
| Multi-Task Learning (MTL) Framework | A machine learning paradigm that jointly learns multiple related tasks (e.g., disease prevalence in different animal populations). It improves data efficiency by leveraging shared information, which is crucial when data is scarce or expensive to collect [38]. |
| Learning Curve Analysis Algorithm | A systematic procedure that maps model accuracy and uncertainty against increasing data sample sizes. This is the primary tool for determining the required dataset size to achieve reliable and stable model predictions [37]. |
| Condition Evaluator & Sampling Regulator | The core software components of an adaptive system. The Condition Evaluator assesses the current state (e.g., disease indicator levels), and the Sampling Regulator converts this information into a decision for the next sampling interval [36]. |
FAQ 1: What are the most critical data fields I must report to meet minimum ethical and security standards? The minimum data standard for wildlife disease research identifies 9 required core data fields essential for standardization and ethical reporting. These mandatory fields ensure data is Findable, Accessible, Interoperable, and Reusable (FAIR) while documenting essential security and provenance information [1] [2]. The table below summarizes these required fields:
Table: Required Data Fields for Ethical Wildlife Disease Data Sharing
| Field Category | Required Fields | Security & Ethical Consideration |
|---|---|---|
| Sampling Data | Date of sampling, Location of sampling | Enables outbreak tracking while requiring potential obfuscation for sensitive species [2] |
| Host Organism Data | Host species identification | Critical for identifying reservoir species and understanding transmission risk [1] |
| Parasite/Pathogen Data | Diagnostic method, Test result, Parasite identification | Essential for accurate threat assessment and biosecurity evaluation [1] |
| Project Metadata | Principal investigator, Funding source, Data license | Ensures accountability and appropriate data use governance [1] |
FAQ 2: How can I share detailed location data while protecting endangered species or preventing misuse? The data standard includes detailed guidance for secure data obfuscation and context-aware sharing [2]. These safeguards are essential to balance transparency with biosafety and prevent misuse such as wildlife culling or bioterrorism [2]. Recommended approaches include:
FAQ 3: What specific information should I include about diagnostic methods to enable proper assessment of biothreat potential? Complete documentation of diagnostic methods is essential for assessing potential biothreat risks and ensuring experimental reproducibility [1]. The required and recommended fields vary by diagnostic approach, as detailed in the table below:
Table: Diagnostic Method Documentation Requirements
| Diagnostic Method | Required Fields | Additional Recommended Fields | Biothreat Assessment Value |
|---|---|---|---|
| PCR-based Methods | Forward primer sequence, Reverse primer sequence, Gene target, Primer citation | PCR conditions, Amplification protocol, Confirmatory test data | Enables assessment of detection specificity and potential for false positives/negatives [1] |
| Immunoassays (ELISA) | Probe target, Probe type, Probe citation | Standard curve data, Control values, Cross-reactivity assessment | Helps evaluate detection sensitivity and potential cross-reactivity with related pathogens [1] |
| Sequencing Methods | GenBank accession, Sequence quality metrics, Assembly method | Raw read repository location, Annotation pipeline, Phylogenetic analysis | Allows independent verification of pathogen identification and genetic risk factors [1] |
FAQ 4: How should I report negative results to maximize their utility for threat assessment without creating data overload? Reporting negative results is mandatory in the minimum data standard because their absence severely constrains secondary analysis and threat assessment [1] [2]. Negative test records should include:
FAQ 5: What are the recommended platforms for sharing wildlife disease data while maintaining appropriate security controls? Researchers should make their data available in findable, open-access generalist repositories (e.g., Zenodo) and/or specialist platforms (e.g., the PHAROS platform) [1]. The emerging HAWK (Health and Wildlife Knowledge) database, slated for release in late 2025, provides specialized infrastructure with enhanced security controls, including strictly private organization accounts, user-specific permission levels, and two-factor authentication [39]. The platform employs a modular approach to data management, enabling components to be added based on specific wildlife health surveillance needs while maintaining data safety, security, and ownership through compartmentalization across organizations and users [39].
Problem: Incomplete metadata jeopardizing data utility for security assessment Solution: Implement a standardized metadata checklist before data publication. The minimum data standard identifies 24 metadata fields (7 required) sufficient to document a dataset for proper security and scientific assessment [1] [2]. Required metadata includes principal investigator contact information, project title and description, funding sources, and data license information [1]. Use the validation tools provided with the standard, including the JSON Schema and the R package (available from GitHub at github.com/viralemergence/wddsWizard) with convenience functions to validate data and metadata against the schema before sharing [1].
Problem: Uncertainty about data licensing options for sensitive wildlife pathogen data Solution: Select licenses that balance openness with security considerations. Recommended approaches include:
Problem: Difficulty formatting data for optimal reuse across different analysis platforms Solution: Adopt the "tidy data" principle where each row corresponds to a single diagnostic test measurement [1]. The standard provides template files in .csv and .xlsx format (available in the supplement of the main paper and from GitHub at github.com/viralemergence/wdds) [1]. Format data following these specifications:
Problem: Managing multi-organizational data sharing while maintaining security protocols Solution: Implement role-based access control through specialized platforms. The HAWK database provides a model for this with strictly private organization accounts where administrators can set user-specific permission levels [39]. The system's compartmentalization approach allows organizations to maintain control over their data while enabling secure collaboration. The forthcoming API will allow interoperability with other systems for data collection, storage, and visualization while maintaining these security protocols [39].
The following workflow illustrates the complete process for standardizing wildlife disease data with ethical and security considerations:
For reporting diagnostic test results with sufficient detail for biothreat assessment:
Sample Preparation Documentation
Test Implementation
Result Interpretation
Security Review
Table: Essential Research Reagent Solutions for Wildlife Disease Studies
| Reagent Category | Specific Examples | Function in Wildlife Disease Research | Security Considerations |
|---|---|---|---|
| Sample Collection & Preservation | RNAlater, Viral Transport Media, Ethanol | Preserves nucleic acid and antigen integrity for accurate pathogen detection | Proper disposal protocols required for biohazard containment |
| Nucleic Acid Extraction Kits | Qiagen DNeasy, Zymo Research kits, MagMax kits | Isulates pathogen genetic material for molecular detection and characterization | Extracted nucleic acids may require secure storage for select agents |
| PCR Reagents | Primer sets targeting conserved pathogen regions, PCR master mixes, Probe-based chemistry | Enables sensitive detection and identification of specific pathogens | Primer sequences must be fully documented for assay validation and threat assessment [1] |
| Positive Controls | Synthetic genetic constructs, Inactivated pathogens, Reference strains | Validates assay performance and enables cross-laboratory comparison | Requires careful biosafety planning; synthetic constructs may reduce need for viable pathogens |
| Antibody Reagents | Species-specific secondary antibodies, Monoclonal antibodies for pathogen detection | Enables serological detection of pathogen exposure or antigen presence | Cross-reactivity patterns must be documented to prevent false positives [1] |
| Data Management Tools | WDDS template files, JSON Schema validator, HAWK database platform | Standardizes data formatting and facilitates secure data sharing | Implements access controls and data embargo capabilities for sensitive information [1] [39] |
Implementing the FAIR Guiding Principles (Findable, Accessible, Interoperable, and Reusable) is critical for enhancing the utility and impact of wildlife disease research data. These principles, developed to improve scientific data management and stewardship, ensure data is structured for both human understanding and machine-actionability, thereby maximizing its potential for reuse and synthesis [41]. In the specific context of wildlife disease research—a field vital for ecological health, pandemic preparedness, and global health security—aligning with FAIR principles addresses longstanding challenges of fragmented, inconsistent data sharing [1] [2]. This technical support guide provides targeted troubleshooting and methodologies to help researchers, scientists, and drug development professionals overcome common barriers in their quest to improve metadata collection and achieve FAIR compliance.
1. What are the FAIR Data Principles and why are they important for wildlife disease research? The FAIR principles are four guiding rules designed to enhance the reusability of data holdings [41]. For wildlife disease research, they are crucial because they enable broader and more effective data aggregation across studies, which bolsters our capacity to detect and respond to emerging infectious threats at the human-animal-environment interface [2]. Adhering to FAIR principles transforms disparate datasets into a cohesive, globally interoperable resource for ecological intelligence and public health decision-making.
2. What is the difference between FAIR data and open data? FAIR data is focused on making data findable, accessible, interoperable, and reusable, but not necessarily publicly available. It emphasizes structure, rich description, and machine-actionability. Open data, in contrast, is data made freely available for anyone to access, use, and share without restrictions, but it may not be structured for computational use. FAIR data can be restricted and secure, while open data is defined by its lack of access restrictions [41].
3. Are there data standards specific to wildlife disease research? Yes. A minimum data and metadata reporting standard has been developed specifically for wildlife disease studies [1]. This standard identifies a set of 40 data fields (9 of which are required) and 24 metadata fields (7 required) sufficient to document a dataset at the finest possible spatial, temporal, and taxonomic scale. Its flexible design accommodates diverse methodologies and is aligned with global biodiversity data standards [1] [2].
4. What are the most common challenges in implementing FAIR principles? Researchers often face several interconnected challenges:
5. How should sensitive data, like precise locations of threatened species, be handled? The FAIR principles do not require that all data be openly accessible. Data can be both private and FAIR. For sensitive information, the wildlife disease data standard includes detailed guidance for secure data obfuscation and context-aware sharing. This balances transparency with biosafety and ethical concerns, preventing misuse such as wildlife culling [2]. The "Accessible" principle allows for data to be retrievable through standardized protocols even when behind secure authentication and authorization layers [41].
.csv for maximum interoperability [1] [2].wddsWizard) from the wildlife disease data standard to check your data's format and completeness before sharing [1].The following workflow diagrams and protocols outline the key steps for collecting, formatting, and sharing wildlife disease data in alignment with FAIR principles and the minimum data standard [1].
Objective: To collect wildlife disease data at the host-level and format it into a "tidy" structure that aligns with the minimum data standard.
Methodology:
.csv or .xlsx available from the standard's GitHub repository) with your data, ensuring all required fields are completed [1].Objective: To annotate the dataset with comprehensive project-level metadata and validate its technical compliance with the data standard.
Methodology:
wddsWizard) with convenience functions to automatically validate your dataset and metadata against the standard [1].Objective: To archive the validated dataset and metadata in a findable, accessible repository to ensure long-term preservation and reuse.
Methodology:
.csv format) and a README file (data dictionary) explaining the variables.Use this table to self-assess your dataset's alignment with the core FAIR principles.
| FAIR Principle | Key Action Item | Completed |
|---|---|---|
| Findable | Data is assigned a unique, persistent identifier (e.g., DOI). | ☐ |
| Rich, machine-readable metadata is provided and indexed in a searchable resource. | ☐ | |
| Accessible | Data is retrievable via a standardized protocol (e.g., HTTPS). | ☐ |
| Metadata is accessible even if the data itself is under restricted access. | ☐ | |
| Interoperable | Data and metadata use formal, accessible, and shared languages (e.g., controlled vocabularies, ontologies). | ☐ |
| The dataset is structured using a community-approved standard (e.g., the wildlife disease minimum data standard). | ☐ | |
| Reusable | Data is thoroughly documented with clear licenses and usage rights. | ☐ |
| The dataset includes detailed provenance, describing how the data was generated. | ☐ |
The following reagents and resources are fundamental to conducting and sharing wildlife disease research.
| Item | Function in Research |
|---|---|
| Minimum Data Standard Template | A pre-formatted .csv or .xlsx file defining the 40 core data fields; ensures data is structured for interoperability and reuse from the start of a project [1]. |
| JSON Schema / R Package (wddsWizard) | A validation tool that checks dataset formatting and completeness against the minimum data standard, ensuring technical compliance before sharing [1]. |
| Controlled Vocabularies & Ontologies | Standardized lists of terms (e.g., for species names, diagnostic assays); critical for making data interoperable across different studies and platforms [1]. |
| Persistent Identifier (DOI) | A permanent unique identifier for a dataset, provided by a repository; makes the dataset citable, findable, and trackable [42]. |
| Generalist Repository (e.g., Zenodo) | A platform for archiving and sharing research outputs; provides a DOI and ensures long-term accessibility of the data [1] [42]. |
Q1: What is the most common mistake that causes data submission to fail?
A: The most common error is incomplete metadata, particularly missing mandatory fields like a unique identifier for the dataset (packageId), a detailed title, and a thorough description of the resource. The GBIF Metadata Profile requires these elements for global discoverability [43].
Q2: How should I handle sensitive location data for endangered or pathogen-affected species? A: Data standards mandate secure data obfuscation. You should generalize high-resolution location data (e.g., to a county or district level) to balance transparency with biosafety and prevent misuse, such as wildlife culling. Detailed guidance for context-aware sharing is available [2].
Q3: Why is it mandatory to report negative test results in wildlife disease surveillance? A: Reporting negative results is crucial for understanding true disease prevalence. Datasets that only include positive detections severely constrain analysis and risk underestimating risks. Including negatives enables rigorous comparisons across time, geography, and host species, making the data more valuable for global health security [2].
Q4: Our research project has multiple funders and institutional partners. How is this represented in metadata? A: You can provide this information by using persistent identifiers. The GBIF Metadata Profile supports integration with infrastructures like the Open Funder Registry (OFR) and Research Organization Registry (ROR) to correctly attribute funding sources and affiliated organizations, increasing the academic visibility of your data [44].
Q5: What is the easiest way to generate a valid metadata file for GBIF? A: Using the Integrated Publishing Toolkit (IPT) is recommended. Its built-in metadata editor provides forms for all necessary information, ensures you use controlled vocabularies correctly, and automatically validates the output against the GBIF Metadata Profile to generate a valid XML file [43].
Problem Your dataset is rejected by the GBIF infrastructure due to invalid metadata.
Solution Follow this systematic checklist to ensure compliance with the GBIF Metadata Profile (GMP).
Verify XML Validity
Check Required Metadata Elements
Table: Core Mandatory Metadata Elements for a GBIF Dataset
| Term Name | Description | Example |
|---|---|---|
packageId |
A Universally Unique Identifier (UUID) for this specific version of the metadata document. | 619a4b95-1a82-4006-be6a-7dbe3c9b33c5/eml-1.xml |
title |
A descriptive title that differentiates the resource from others. Multiple language titles are supported. | Vernal pool amphibian density data, Isla Vista, 1990-1996 |
creator |
The person or organization responsible for creating the resource itself. | |
metadataProvider |
The person or organization responsible for the metadata documentation. | |
contact |
The person or institution to contact with questions about the use or interpretation of the dataset. |
Validate Against the Correct Schema
xsi:schemaLocation="eml://ecoinformatics.org/eml-2.1.1 http://rs.gbif.org/schema/eml-gbif-profile/1.1/eml.xsd" [43].Problem Your wildlife disease dataset is published on GBIF but does not appear in searches for related topics like "avian influenza" or "zoonotic pathogens."
Solution Enhance your metadata with thematic and methodological context.
This protocol outlines the steps to format and document a wildlife pathogen surveillance dataset for publication through the GBIF network, aligning with the new minimum data standard for wildlife disease research [2].
1. Principle To ensure wildlife disease data is Findable, Accessible, Interoperable, and Reusable (FAIR), it must be structured according to established biodiversity data standards (e.g., Darwin Core) and enriched with project-specific metadata that provides critical context for One Health applications.
2. Materials and Reagents Table: Research Reagent Solutions for Data Interoperability
| Item Name | Function |
|---|---|
| GBIF Integrated Publishing Toolkit (IPT) | A software application used to validate, manage, and publish biodiversity datasets and their metadata to the GBIF network [43]. |
| Darwin Core Archive (DwC-A) | A standardized and widely adopted format for publishing biodiversity data, which bundles core data, extensions, and metadata into a single, interoperable package [43]. |
| Ecological Metadata Language (EML) | The schema upon which the GBIF Metadata Profile is based, used to formally describe the dataset in a machine-readable way [43]. |
| HAWK Database | A purpose-built database (release slated for late 2025) for managing harmonized wildlife health surveillance data with compartmentalized security, supporting FAIR and CARE principles [46]. |
| Minimum Data Standard for Wildlife Disease | A published standard encompassing 40 data fields (9 required) and 24 metadata fields (7 required) to ensure transparency and reusability of wildlife disease data [2]. |
3. Procedure
Step 1: Data Compilation and Formatting 1.1. Structure your core data (occurrences, sampling events) using Darwin Core terms in a spreadsheet or database. 1.2. Apply the minimum data standard for wildlife disease. Ensure your dataset includes the 9 required fields, such as diagnostic outcome, host species, and precise sampling context [2]. 1.3. Crucially, include all negative test results to allow for accurate prevalence calculations [2].
Step 2: Metadata Creation 2.1. Using the GBIF IPT, fill in the metadata forms. The workflow involves a logical progression through 12 forms to capture all necessary information [43]. 2.2. In the "Methods" section, detail the diagnostic assays used (e.g., PCR, ELISA) and any sample pooling strategies. 2.3. In the "Project Data" section, link your dataset to broader surveillance initiatives or funding bodies.
Step 3: Validation and Publication 3.1. The IPT will automatically validate your metadata against the GBIF Metadata Profile, checking for missing mandatory fields and correct formatting [43]. 3.2. Upon successful validation, use the IPT's "Publish" function to make your resource publicly available and register it with GBIF, making it globally discoverable [43].
The following workflow diagram visualizes this multi-step experimental protocol:
Q1: What is the most effective sample type for detecting bat coronaviruses? Meta-analyses of pre-pandemic surveillance data indicate that the choice of sample type significantly influences detection success. Rectal and faecal samples consistently provide the highest coronavirus detection rates. Fewer studies reported using urine samples, which showed a much lower positivity rate. Oral swabs offer an intermediate level of detection and are valuable for assessing respiratory shedding [47].
Q2: Which bat species and geographical regions are under-sampled, creating surveillance gaps? Substantial taxonomic and spatial biases exist in current surveillance efforts. Key gaps include:
Q3: What sampling design best maximizes coronavirus detection and provides robust data? Longitudinal sampling (repeat sampling of the same site over time) is a key predictor of virus detection. It helps account for seasonal variations in viral prevalence and shedding intensity. However, fewer than one in five studies historically employed this design. Single sampling events can bias prevalence estimates and lead to non-randomly missing data, limiting the understanding of viral dynamics [47].
Q4: Does euthanizing bats improve coronavirus detection rates? No. Analysis of pooled data found that euthanasia did not improve virus detection rates. This indicates that non-lethal sampling methods are equally effective for surveillance, which is crucial for the ethical study of bats, many of which are species of conservation concern [47].
Q5: What host ecological factors are associated with coronavirus infection? Recent studies have identified several host factors linked to coronavirus detection. Binary logistic regression analyses reveal that roost type, sample type, and bat species are significantly associated with coronavirus positivity. Furthermore, infections and co-infections are often highest among juvenile and subadult bats, particularly around the time of weaning [48] [49].
| Issue | Possible Cause | Solution |
|---|---|---|
| Low viral detection rate in collected samples. | Suboptimal sample type used; sampling not aligned with peak viral shedding periods. | Prioritize rectal and faecal sampling [47]. Implement longitudinal studies to capture seasonal peaks, which often coincide with periods of high co-infections in immature bats [49]. |
| Inability to track individual bats or compare prevalence across studies. | Lack of consistent, fine-scale metadata collection for each sample. | Adhere to a minimum data reporting standard. Record essential host (species, sex, age), spatial (GPS coordinates), and temporal (date) metadata for every sample [1]. |
| Ethical concerns and conservation impact of sampling. | Belief that lethal sampling is necessary for effective detection. | Employ non-lethal sampling protocols. Euthanasia has not been shown to improve coronavirus detection rates [47]. Follow guidelines from IUCN and WOAH for ethical wildlife surveillance [50]. |
| Issue | Possible Cause | Solution |
|---|---|---|
| False negative or false positive PCR results. | Pre-analytical errors (e.g., sample degradation), primer mismatches due to high viral diversity, or assay cross-contamination [51]. | Use validated pan-coronavirus consensus primers targeting conserved regions like the RdRp gene [47] [48]. Implement strict quality control and contamination protocols. For novel viruses, confirm results with sequencing [52]. |
| Difficulty replicating another study's results or aggregating data. | Inconsistent diagnostic methods, primer sets, or a lack of shared negative data. | Report detailed methodology, including primer sequences and citations [47] [1]. Publicly share both positive and negative results in a disaggregated format to enable robust comparative analysis [1]. |
| High rates of co-infection and recombination complicating analysis. | Circulation of multiple coronavirus clades within a bat population, especially in juveniles. | Use metabarcoding approaches or next-generation sequencing to identify and differentiate co-infecting viruses [49]. Be aware that recombination is common and can be a source of new viral diversity [52] [49]. |
This is a standard method for initial screening of bat samples for coronaviruses, as used in multiple studies [48] [53].
1. RNA Extraction:
2. cDNA Synthesis:
3. Nested PCR Amplification:
4. Sequencing and Analysis:
The following diagram illustrates a comprehensive workflow for surveillance, from field sampling to data reporting, emphasizing standardization.
The following table details key reagents and materials used in bat coronavirus research.
| Research Reagent | Function / Application |
|---|---|
| Consensus Primers (RdRp gene) | Targets conserved regions of the coronavirus genome for broad detection via PCR. Crucial for initial screening of diverse bat coronaviruses [47] [48]. |
| Viral Transport Media (VTM) | Preserves viral RNA integrity in field-collected swabs (oral, rectal) during transport from the capture site to the laboratory [48]. |
| RNA Extraction Kits (Trizol LS) | Isolates high-quality total RNA, including viral RNA, from various sample matrices like faeces, swabs, and tissue homogenates [48]. |
| Next-Generation Sequencing (NGS) | Provides complete viral genomes, enabling precise identification, analysis of recombination events, and assessment of zoonotic potential [53] [52] [49]. |
| Pan-Coronavirus RT-PCR Assays | Standardized molecular tests for detecting a wide range of known and potentially novel coronaviruses in bat samples [48] [52]. |
Adhering to a minimum data standard is fundamental for interoperability and reuse. The following diagram shows the logical relationships between core data entities in a standardized wildlife disease study [1].
One Health surveillance recognizes the interconnectedness of human, animal, and environmental health. Effective systems require standardized methods for communicating and archiving data, enabling participants to easily share findings and allow others to build upon them [54]. The broader landscape encompasses multiple sectors and data types, including human health, animal health (encompassing wildlife, domestic animals, and livestock), and environmental monitoring [55] [56].
Integration mechanisms in this landscape vary from simple data sharing to fully converged systems. A systematic review identified four primary integration mechanisms: interoperability (systems working together), convergent integration (merging technology with business processes), semantic consistency (standard data definitions), and interconnectivity (simple file transfer) [55]. These integration approaches aim to enhance key surveillance attributes, including sensitivity, timeliness, and data quality [55].
Table: Integration Mechanisms in One Health Surveillance
| Integration Mechanism | Key Characteristics | Reported Impact on Surveillance |
|---|---|---|
| Interoperability [55] | Ability of systems to work together and exchange data | Most common mechanism; enhances sensitivity and timeliness |
| Convergent Integration [55] | Merging technology with processes, knowledge, and human performance | Highest, most sophisticated form of integration |
| Semantic Consistency [55] | Implementation of standard data definitions and formats | Minimizes errors in human interpretation |
| Interconnectivity [55] | Sharing external devices or transferring files | Basic integration with little change to core functions |
The wildlife disease data standard directly supports One Health integration through its structured format and standardized vocabulary, which enable data from disparate sources to be combined and analyzed jointly. The standard provides a common structure for data that spans host, pathogen, and environmental contexts, creating a foundational element for semantic consistency across sectors [1]. By including detailed information about host organisms, sampling methods, diagnostic results, and parasite characterization, the standard ensures that wildlife disease data can be effectively integrated with human health and domestic animal surveillance data [1] [56]. This interoperability is crucial for tracking zoonotic diseases that move across the human-animal-environment interface.
Researchers most frequently encounter compatibility issues related to metadata formatting, vocabulary inconsistencies, and data granularity when integrating with broader One Health platforms.
Table: Common Compatibility Issues and Solutions
| Compatibility Issue | Description | Recommended Solution |
|---|---|---|
| Metadata Formatting | Mismatch between data models (e.g., SSD2, Darwin Core) | Map fields to common standards; use conversion tools |
| Vocabulary Inconsistencies | Different terms for same concepts across sectors | Adopt existing controlled vocabularies and ontologies |
| Data Granularity Mismatches | Aggregated data vs. individual-level records | Share data at finest possible spatial, temporal, and taxonomic scale |
| Identifier Systems | Lack of common identifiers for samples and hosts | Implement persistent identifiers and cross-referencing systems |
Additional challenges include technical barriers to understanding FAIR data standards and reluctance to share data across sectors [57]. Successful integration requires addressing these issues through cross-sector engagement and co-development of system scope [56].
Implementing standardized data approaches significantly enhances key surveillance system performance metrics. Research shows that integrated surveillance systems demonstrate:
These improvements stem from the standard's ability to facilitate more complete data collection, faster data exchange, and more accurate interpretation across sectors [55].
Problem: Data fails to validate against the standard's schema or cannot be imported into One Health platforms.
Solution:
Problem: Terms used in your dataset don't align with terminology in connected One Health systems, causing integration failures.
Solution:
Problem: Difficulty linking wildlife disease data with pathogen genomic data in platforms like NCBI Pathogen Detection.
Solution:
Purpose: To systematically collect and format wildlife disease data according to the standard for seamless integration with broader One Health surveillance platforms.
Methodology:
Purpose: To validate that data formatted according to the wildlife disease standard can be successfully integrated with target One Health surveillance platforms.
Methodology:
Table: Essential Tools and Resources for Implementing the Data Standard
| Resource Category | Specific Tool/Resource | Function/Purpose |
|---|---|---|
| Data Validation Tools | JSON Schema implementation [1] | Validates data structure against standard specifications |
| Programming Utilities | wddsWizard R package [1] | Convenience functions for data validation and standardization |
| Data Templates | .csv and .xlsx template files [1] | Pre-formatted structures for data entry |
| Vocabulary Resources | Supported ontologies and controlled vocabularies [1] | Ensures semantic consistency across datasets |
| Integration Platforms | PHAROS database [1] | Dedicated platform for wildlife disease data |
| General Repositories | Zenodo, NCBI [1] [54] | Open-access repositories for data sharing |
| Interoperability Frameworks | One Health Surveillance Codex [59] | Resources for data harmonization and interpretation |
| Reporting Standards | EFSA SSD2 data model [58] | Standard for reporting to European authorities |
The adoption of a unified minimum data standard for wildlife disease metadata is a transformative step for both ecological research and global health security. By providing a clear, practical framework for data collection and sharing, this standard directly addresses the critical data fragmentation that has long hindered synthetic analysis and predictive modeling. For researchers and drug development professionals, this means access to higher-quality, more comparable data that can illuminate disease dynamics, accelerate the identification of emerging threats, and inform therapeutic and vaccine development. Widespread implementation will strengthen our collective early-warning system, turning disparate data points into a powerful, actionable intelligence network for pandemic prevention. The future of wildlife disease research depends on our ability to speak a common data language—this standard provides the essential lexicon.